Categories
Prostate cancer

African-specific molecular taxonomy of prostate cancer

Patient cohorts and WGS

Our study included 183 treatment-naive patients with prostate cancer who were recruited under informed consent and appropriate ethics approval (Supplementary Information 2) from Australia (n = 53), Brazil (n = 7) and South Africa (n = 123). While matched for pathological grading, as previously reported, prostate-specific antigen levels are notably elevated within our African patients16 and we cannot exclude on the basis of potential metastasis (as data on metastases in this cohort are unavailable). DNA extracted from fresh tissue and matched blood underwent 2 × 150 bp sequencing on the Illumina NovaSeq instrument (Kinghorn Centre for Clinical Genomics, Garvan Institute of Medical Research).

WGS processing and variant calling

Each lane of raw sequencing reads was aligned against human reference hg38 + alternative contigs using bwa (v.0.7.15)37. Lane-level BAM files from the same library were merged, and duplicate reads were marked. The Genome Analysis Toolkit (GATK, v.4.1.2.0) was used for base quality recalibration38. Contaminated and duplicate samples (n = 8) were removed. We implemented three main pipelines for the discovery of germline and somatic variants, with the latter including small (SNV and indel) to large genomic variation (CNAs and SVs). The complete pipelines and tools used are available from the Sydney Informatics Hub (SIH), Core Research Facilities, University of Sydney (see the ‘Code availability’ section). Scalable bioinformatic workflows are described in Supplementary Information 4.

Genetic ancestry was estimated using fastSTRUCTURE (v.1.0)39, Bayesian inference for the best approximation of marginal likelihood of a very large variant dataset. Reference panels for African and European ancestry compared in this study were retrieved from previous whole-genome databases19.

Analysis of chromothripsis and chromoplexy

Clustered genomic rearrangements of prostate tumours were identified using ShatterSeek (v.0.4)40 and ChainFinder (v.1.0.1)41. Our somatic SV and somatic CNA call sets were prepared and co-analysed using custom scripts (see the ‘Code availability’ section; Supplementary Information 6).

Analysis of mutational recurrence

We used three approaches to detect recurrently mutated genes or regions based on three mutational types, including small mutations, SVs and CNAs (Supplementary Information 7). In brief, small mutations were tested within a given genomic element as being significantly more mutated than the adjacent background sequences. The genomic elements retrieved from syn5259886, the PCAWG Consortium20, were a group of coding sequences and ten groups of non-coding regions. SV breakpoints were tested in a given gene for their statistical enrichment using gamma–Poisson regression and corrected by genomic covariates12. Focal and arm-level recurrent CNAs were examined using GISTIC (v.2.0.23)42. Known driver mutations in coding and non-coding regions published in PCAWG20,43,44 were also recorded in our 183 tumours, and those specific to prostate cancer genes were also included7,8,12,17,18.

Integrative analysis of prostate cancer subtypes

Integrative clustering of three genomic data types for 183 patients was performed using iClusterplus11,45 in R, with the following inputs: (1) driver genes and elements; (2) somatic CN segments; and (3) significantly recurrent SV breakpoints. We ran iClusterPlus.tune with clusters ranging from 1 to 9. We also performed unsupervised consensus clustering on each of the three data types individually. Association analysis of genomic alteration with different iCluster subtypes was performed in detail (Supplementary Information 8). Differences in driver mutations, recurrent breakpoints and somatic CNAs across different iCluster subtypes were reported.

Comparison of iCluster with Asian and pan-cancer data

To compare molecular subtypes between extant human populations, the Chinese Prostate Cancer Genome and Epigenome Atlas (CPGEA, PRJCA001124)11 was merged and processed with our integrative clustering analysis across the three data types described above, with some modifications. Moreover, we leveraged the PCAWG consortium data13 to define molecular subtypes across different ethnic groups in other cancer types using published data of somatic mutations, SV and GISTIC results by gene. Four cancer types consisting of breast, liver, ovarian and pancreatic cancers were considered due to existing primary ancestries of African, Asian and European with at least 70% contribution. Full details are provided in Supplementary Information 8.4.

PCAWG13 participants with prostate cancer were retrieved to compare with Australian data with clinical follow-up. Only those of European ancestry greater than 90% (n = 139) were analysed for the three genomic data types of iCluster subtyping, as well as individual consensus clustering. Clustering results identical to the larger cohort size mentioned above were chosen for association analyses. Differences in the biochemical relapse and lethal prostate cancer of the participants across the subtypes were assessed using the Kaplan–Meier plot followed by a log-rank test for significance.

Analysis of mutational signatures

Mutational signatures (SBSs, DBSs and indels), as defined by the PCAWG Mutational Signatures Working Group3, were fit to individual tumours with observed signature activities using SigProfiler46. Non-negative matrix factorization was implemented to detect de novo and global signature profiles among 183 patients and their contributions. New mutational genome rearrangement signatures (CN and SV) were also performed using non-negative matrix factorization, with 45 CN and 44 SV features examined across 183 tumours. We followed the PCAWG working classification and annotation scheme for genomic rearrangement26. Two SV callers were used to obtain exact breakpoint coordinates. Replication timing scores influencing on SV detection were set at >75, 20–75 and <20 for early, mid, and late timing, respectively47. Full details of analysis steps, parameters and relevant statistical tests are provided in Supplementary Information 9.

Reconstruction of cancer timelines

Timing of CN gains and driver mutations (SNVs and indels) into four epochs of cancer evolution (early clonal, unspecified clonal, late clonal and subclonal) was conducted using MutationTimeR24. CN gains including 2 + 0, 2 + 1 and 2 + 2 (1 + 1 for a diploid genome) were considered for a clearer boundary between epochs instead of solely information of variant allele frequency. Confidence intervals (tlo – tup) for timing estimates were calculated with 200 bootstraps. Mutation rates for each subtype were calculated according to ref. 24 such that CpG-to-TpG mutations were counted for the analysis because they were attributed to spontaneous deamination of 5-methyl-cytosine to thymine at CpG dinucleotides, therefore acting as a molecular clock.

League model relative ordering was performed to aggregate across all study samples to calculate the overall ranking of driver mutations and recurrent CNAs. The information for the ranking was derived from the timing of each driver mutation and that of clonal and subclonal CN segments, as described above. A full description is provided in Supplementary Information 10.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Categories
Prostate cancer

The Prostate Cancer Foundation and Olympic Freestyle Skier Winter Vinecki Challenge Americans to “Get Healthy” During Prostate Cancer Awareness Month

LOS ANGELES, Calif., August 30, 2022 – The Prostate Cancer Foundation (PCF) challenges Americans to show their support for men affected by prostate cancer by taking a simple challenge to get active and eat healthfully during Prostate Cancer Awareness Month in September. Olympic freestyle aerial skier and PCF celebrity ambassador Winter Vinecki joins PCF’s “Get Healthy” campaign, a national effort to raise awareness about prostate cancer and show that making healthy lifestyle choices can have a meaningful impact in potentially reducing risk and improving outcomes.

“It’s so important that men and their families understand the link between lifestyle and prostate cancer. I’m committed to do everything I can to support the “Get Healthy” challenge which, in turn, will raise awareness about prostate cancer risk and save lives,” said Vinecki, a freestyle skier and member of Team USA at the Olympic Winter Games Beijing 2022.

“We are so honored to have Winter help PCF create awareness about the correlation between healthy lifestyles and prostate cancer risk,” said PCF President and CEO Charles J. Ryan, MD. “Lifestyle modifications have been convincingly shown to reduce the risk of the onset of cancer and progression, including prostate cancer. Men who adopt these healthier lifestyle changes can help reduce prostate cancer risk, especially Black men who are at a higher risk for developing the disease.”

One in eight men will be diagnosed with prostate cancer in his lifetime. For Black men, it’s one in six, and they are twice as likely to die from it as white men. Lifestyle factors, like exercise and healthy eating, play a significant role in health risks, health equity, and outcomes. While eating healthy and exercising can’t stop you from getting cancer, research shows that it can lower your risk.

To help create awareness about the link between healthy lifestyles and reduced cancer risk, PCF invites the public to take on the challenge of running, walking or hiking 108 miles in 30 days for the one in eight men who will be diagnosed with prostate cancer in their lifetime. They are invited to join a private Facebook group, create a personal Facebook fundraiser, and challenge themselves to raise money for life-saving prostate cancer research and walk away with better health. Americans can also take the “30 Foods in 30 Days” healthy eating challenge, by eating 30 foods selected from PCF’s Periodic Table of Healthy Foods.

All healthy eating challenge participants will receive PCF’s wellness guide, “The Science of Living Well, Beyond Cancer” which encompasses the latest scientific recommendations for cancer prevention and overall health, including actionable tips for optimal nutrition, exercise, and rest. The wellness guide is not just for men with living with prostate cancer, but for anyone interested in living well and reducing their risk for cancer.

During Prostate Cancer Awareness Month PCF is also launching a new patient-focused webinar series hosted by President and CEO Charles J. Ryan, MD. Each month, Dr. Ryan will speak with leaders in the field of prostate cancer diagnosis, treatment, research, and survivorship and take questions from the audience during these live virtual events. The inaugural two-part webinar will take place virtually on September 20, 2022, at 4:30 p.m. PDT/7:30 p.m. EDT. “Prostate 8” will feature a discussion of simple lifestyle changes and prostate health with PCF-funded investigator Dr. Stacey Kenfield, ScD, Associate Professor of Urology, University of California San Francisco. “Mental Health and Prostate Cancer” will focus on mental wellness with Dr. Andrew Roth, attending psychiatrist at Memorial Sloan Kettering Cancer Center. Register for the webinar here. The Health and Wellness webinar is supported by a grant from AstraZeneca.

Join the Prostate Cancer Foundation’s “Get Healthy” Challenges at https://www.pcf.org/pcam2022/. Connect with PCF at www.pcf.org, on Facebook (facebook.com/pcf.org),  Instagram (@prostatecancerfoundation), or Twitter (@pcfnews).

ABOUT PCF

The Prostate Cancer Foundation (PCF) is the world’s leading philanthropic organization dedicated to funding life-saving prostate cancer research. Founded in 1993 by Mike Milken, PCF has been responsible for raising close to $1 billion in support of cutting-edge research by more than 2,200 research projects at 245 leading cancer centers in 28 countries around the world. Since PCF’s inception, and through its efforts, patients around the world are living longer, suffering fewer complications, and enjoying better quality of life. PCF is committed to creating a global public square for prostate cancer, in service to our mission of ending death and suffering from the disease. Learn more at pcf.org.

#   #   #

MEDIA CONTACT:
Staci L. Vernick
Prostate Cancer Foundation
[email protected]
610-812-6092

Categories
Prostate cancer

High dose androgen suppresses natural killer cytotoxicity of castration-resistant prostate cancer cells via altering AR/circFKBP5/miRNA-513a-5p/PD-L1 signals

  • Huggins C, Hodges CV. Studies on prostatic cancer: I. The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. 1941. J Urol. 2002;168:9–12.

    PubMed 
    Article 

    Google Scholar
     

  • Schweizer MT, Antonarakis ES, Wang H, Ajiboye AS, Spitz A, Cao H, et al. Effect of bipolar androgen therapy for asymptomatic men with castration-resistant prostate cancer: results from a pilot clinical study. Sci Transl Med. 2015;7:269ra2.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Gregory CW, He B, Johnson RT, Ford OH, Mohler JL, French FS, et al. A mechanism for androgen receptor-mediated prostate cancer recurrence after androgen deprivation therapy. Cancer Res. 2001;61:4315–9.

    CAS 
    PubMed 

    Google Scholar
     

  • Montgomery RB, Mostaghel EA, Vessella R, Hess DL, Kalhorn TF, Higano CS, et al. Maintenance of intratumoral androgens in metastatic prostate cancer: a mechanism for castration-resistant tumor growth. Cancer Res. 2008;68:4447–54.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Stanbrough M, Bubley GJ, Ross K, Golub TR, Rubin MA, Penning TM, et al. Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer. Cancer Res. 2006;66:2815–25.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • De Bono JS, Chowdhury S, Feyerabend S, Elliott T, Grande E, Melhem-Bertrandt A, et al. Antitumour activity and safety of enzalutamide in patients with metastatic castration-resistant prostate cancer previously treated with abiraterone acetate plus prednisone for ≥ 24 weeks in Europe. Eur Urol. 2018;74:37–45.

    PubMed 
    Article 
    CAS 

    Google Scholar
     

  • Armstrong AJ, et al. ARCHES: a randomized, phase III study of androgen deprivation therapy with enzalutamide or placebo in men with metastatic hormone-sensitive prostate cancer. J Clin Oncol. 2019;37:2974–86.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Antonarakis ES, Lu C, Wang H, Luber B, Nakazawa M, Roeser JC, et al. AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. N. Engl J Med. 2014;371:1028–38.

    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar
     

  • Teply BA, Wang H, Luber B, Sullivan R, Rifkind I, Bruns A, et al. Bipolar androgen therapy in men with metastatic castration-resistant prostate cancer after progression on enzalutamide: an open-label, phase 2, multicohort study. Lancet Oncol. 2018;19:76–86.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Vander Griend DJ, Litvinov IV, Isaacs JT. Stabilizing androgen receptor in mitosis inhibits prostate cancer proliferation. Cell Cycle. 2007;6:647–51.

    Article 

    Google Scholar
     

  • Haffner MC, Aryee MJ, Toubaji A, Esopi DM, Albadine R, Gurel B, et al. Androgen-induced TOP2B-mediated double-strand breaks and prostate cancer gene rearrangements. Nat Genet. 2010;42:668–75.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Haffner MC, De Marzo AM, Meeker AK, Nelson WG, Yegnasubramanian S. Transcription-induced DNA double strand breaks: both oncogenic force and potential therapeutic target? Clin Cancer Res. 2011;17:3858–64.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Chen W, Beck I, Schober W, Brockow K, Effner R, Buters JT, et al. Human mast cells express androgen receptors but treatment with testosterone exerts no influence on IgE-independent mast cell degranulation elicited by neuromuscular blocking agents. Exp Dermatol. 2010;19:302–4.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Mantalaris A, Panoskaltsis N, Sakai Y, Bourne P, Chang C, Messing EM, et al. Localization of androgen receptor expression in human bone marrow. J Pathol. 2001;193:361–6.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Viselli SM, Reese KR, Fan J, Kovacs WJ, Qlsen NJ. Androgens alter B cell development in normal male mice. Cell Immunol. 1997;182:99–104.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Pu Y, Xu M, Liang Y, Yang K, Guo Y, Yang X, et al. Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor relapse. Sci Transl Med. 2016;8:333ra47.

    PubMed 
    Article 
    CAS 

    Google Scholar
     

  • Seki T, Shimizu Y, Ishii K, Takahama Y, Kato K, Yano TNK. cells can preferentially target prostate cancer stem-like cells via the TRAIL/DR5 signalling pathway. Biomolecules. 2021;11:1702.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Kaja S, Payne AJ, Singh T, Ghuman JK, Sieck EG, Koulen P. An optimized lactate dehydrogenase release assay for screening of drug candidates in neuroscience. J Pharm Toxicol Methods. 2015;73:1–6.

    CAS 
    Article 

    Google Scholar
     

  • Hsu J, Hodgins JJ, Marathe M, Nicolai CJ, Bourgeois-Daigneault MC, Trevino TN, et al. Contribution of NK cells to immunotherapy mediated by PD-1/PD-L1 blockade. J Clin Invest. 2018;128:4654–68.

    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, et al. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384–8.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Han D, Li J, Wang H, Su X, Hou J, Gu Y, et al. Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression. Hepatology. 2017;66:1151–64.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Zhang C, Xiong J, Yang Q, Wang Y, Shi H, Tian Q, et al. Profiling and bioinformatics analyses of differential circular RNA expression in prostate cancer cells. Future Sci OA. 2018;4:FSOA340.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Vivier E, Raulet DH, Moretta A, Caligiuri MA, Zitvogel L, Lanier LL, et al. Innate or adaptive immunity? The example of natural killer cells. Science. 2011;331:44–49.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Coca S, Perez-Piqueras J, Martinez D, Colmenarejo A, Saez MA, Vallejo C, et al. The prognostic significance of intratumoral natural killer cells in patients with colorectal carcinoma. Cancer. 1997;79:2320–8.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Ishigami S, Natsugoe S, Tokuda K, Nakajo A, Che X, Iwashige H, et al. Prognostic value of intratumoral natural killer cells in gastric carcinoma. Cancer. 2000;88:577–83.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Antognelli C, Mandarano M, Prosperi E, Sidoni A, Talesa VN. Glyoxalase-1-dependent methylglyoxal depletion sustains PD-L1 expression in metastatic prostate cancer cells: a novel mechanism in cancer immunosurveillance escape and a potential novel target to overcome PD-L1 blockade resistance. Cancers (Basel). 2021;13:2965.

    CAS 
    Article 

    Google Scholar
     

  • Barry KC, Hsu J, Broz ML, Cueto FJ, Binnewies M, Combes AJ, et al. A natural killer-dendritic cell axis defines checkpoint therapy-responsive tumor microenvironments. Nat Med. 2018;24:1178–91.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Trefny MP, Rothschild SI, Uhlenbrock F, Rieder D, Kasenda B, Stanczak MA, et al. A variant of a killer cell immunoglobulin-like receptor is associated with resistance to PD-1 blockade in lung cancer. Clin Cancer Res. 2019;25:3026–34.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Iannello A, Thompson TW, Ardolino M, Marcus A, Raulet DH. Immunosurveillance and immunotherapy of tumors by innate immune cells. Curr Opin Immunol. 2016;38:52–58.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Chuu CP, Hiipakka RA, Fukuchi J, Kokontis JM, Liao ST. Androgen causes growth suppression and reversion of androgen-independent prostate cancer xenografts to an androgen-stimulated phenotype in athymic mice. Cancer Res. 2005;65:2082–4.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Kokontis JM, Hay N, Liao S. Progression of LNCaP prostate tumor cells during androgen deprivation: hormone-independent growth, repression of proliferation by androgen, and role for p27Kip1 in androgen-induced cell cycle arrest. Mol Endocrinol. 1998;12:941–53.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Pope HG, Kouri EM, Hudson JI. Effects of supraphysiologic doses of testosterone on mood and aggression in normal men: a randomized controlled trial. Arch Gen Psychiatry. 2000;57:133–40. discussion 155-156

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Ritch CR, Cookson MS. Advances in the management of castration resistant prostate cancer. BMJ. 2016;355:i4405.

    PubMed 
    Article 

    Google Scholar
     

  • Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. N. Engl J Med. 2012;366:2443–2254.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Graff JN, Alumkal JJ, Drake CG, Thomas GV, Redmond WL, Farhad M, et al. Early evidence of anti-PD-1 activity in enzalutamide-resistant prostate cancer. Oncotarget. 2016;7:52810–7.

    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Le DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade. Science. 2017;357:409–13.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Reck M, Rodríguez-Abreu D, Robinson AG, Hui R, Csőszi T, Fülöp A, et al. Pembrolizumab versus chemotherapy for PD-L1-positive non-small-cell lung cancer. N Engl J Med. 2016;375:1823–33.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Yarchoan M, Hopkins A, Jaffee EM. Tumor mutational burden and response rate to PD-1 inhibition. N Engl J Med. 2017;377:2500–1.

    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Xia Q, Ding T, Zhang G, Li Z, Zeng L, Zhu Y, et al. Circular RNA expression profiling identifies prostate cancer- specific circRNAs in prostate cancer. Cell Physiol Biochem. 2018;50:1903–15.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Kong Z, Wan X, Zhang Y, Zhang P, Zhang Y, Zhang X, et al. Androgen-responsive circular RNA circSMARCA5 is up-regulated and promotes cell proliferation in prostate cancer. Biochem Biophys Res Commun. 2017;493:1217–23.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013;495:333–8.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Chen KC, Chen PH, Ho KH, Shih CM, Chou CM, Cheng CH, et al. IGF-1-enhanced miR-513a-5p signaling desensitizes glioma cells to temozolomide by targeting the NEDD4L-inhibited Wnt/beta-catenin pathway. PLoS One. 2019;14:e0225913.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Kanwal R, Plaga AR, Liu XQ, Shukla GC, Gupta S. MicroRNAs in prostate cancer: functional role as biomarkers. Cancer Lett. 2017;407:9–20.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Fabris L, Ceder Y, Chinnaiyan AM, Jenster GW, Sorensen KD, Tomlins S, et al. The potential of MicroRNAs as prostate cancer biomarkers. Eur Urol. 2016;70:312–22.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Muti P, Donzelli S, Sacconi A, Hossain A, Ganci F, Frixa T, et al. MiRNA-513a-5p inhibits progesterone receptor expression and constitutes a risk factor for breast cancer: the hOrmone and Diet in the ETiology of breast cancer prospective study. Carcinogenesis. 2018;39:98–108.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Dai N, Qing Y, Cun Y, Zhong Z, Li C, Zhang S, et al. miR-513a-5p regulates radiosensitivity of osteosarcoma by targeting human apurinic/apyrimidinic endonuclease. Oncotarget. 2018;9:25414–26.

    PubMed 
    Article 

    Google Scholar
     

  • Categories
    Prostate cancer

    MicroRNA-375 is a therapeutic target for castration-resistant prostate cancer through the PTPN4/STAT3 axis

    Preparation of cell lines, tissue specimens, and reagents

    DU145, PC-3, LNCaP and BPH1 cells (the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences, Shanghai, China) were maintained in RPMI 1640 (Biological Industries, Israel), and HEK-293 cells were maintained in DMEM (Biological Industries, Israel). Both basal media were supplemented with 10% FBS (Biological Industries, Israel) and 1% penicillin–streptomycin (Beyotime Biotechnology, Shanghai, China). All of the cells were incubated at 37 °C in a humidified environment supplied with 5% CO2.

    We collected 30 PCa and 17 benign prostate hyperplasia tissues from Harbin Medical University Cancer Hospital.

    Enzalutamide (Selleck, Houston, USA) was dissolved in DMSO (Sigma-Aldrich, USA) and stored at −20 °C until use. Sequences of PMOs (Gene Tools, https://www.gene-tools.com/, USA) were as follows: miR-375 antisense PMO (miR-375i): GCCTCACGCGAGCCGAACGAACAAA and negative control (NC): CCTCTTACCTCAGTTACAATTTATA. The oligomers were dissolved in PBS and stored at 4 °C until use.

    MiRNA in situ hybridization (ISH)

    A tissue microarray composed of 150 specimens (3 healthy prostate, 54 paracancerous tissues and 93 prostate cancer tissues) (Shanghai Outdo Biotech, China) was used to assess miR-375 levels with a miRNAscope Kit RED (#324500, Advanced Cell Diagnostics, USA). Briefly, dewaxed tissue slide was hybridized with the customized miR-375-specific probe (Advanced Cell Diagnostics, USA) at 40 °C for 2 h. Then, the slide was subjected to signal amplification using an HD Reagent detection kit, and the hybridization signal was visualized with a DAB kit. A MiRNAscope positive control probe (#727871-S1, Advanced Cell Diagnostics, USA) and negative control probe (#727881-S1, Advanced Cell Diagnostics, USA) were used to ensure the interpretability of the hybridization. The signals were scored based on the following semi-quant guidelines: 0 (≤1 dot per cell), 1 (2–10 dots per cell and very few dot clusters), 2 (11–20 dots per cell and <25% dots were enclosed by clusters), and 3 (>20 dots per cell and >25% dots were enclosed by clusters).

    Bioinformatic analysis

    EvmiRNA was used to assess miR-375 expression in different cancer-derived exosomes and microvesicles. The transcriptive data of miR-375 between disparate cancer tissues and normal control tissues were from The Cancer Genome Atlas (TCGA) and processed with R software (version 3.6.3). We also interrogated databases to calculate the unique expression levels of miR-375 (Starbase http://starbase.sysu.edu.cn/index.php) and PTPN4 (UALCAN http://ualcan.path.uab.edu/) in tumor and normal tissues) and the correlation between miR-375 and PTPN4. MiRWalk (http://mirwalk.umm.uni-heidelberg.de/), TargetScan (http://www.targetscan.org/vert_72/), StarBase, miRsystem (http://mirsystem.cgm.ntu.edu.tw/) and RNA22V2 (https://cm.jefferson.edu/rna22/Interactive/)were used to predict target genes of miR-375. The relationship between miR-375 and patients’ cancer stages of PCa was explored using Kruskal-Wallis R Test in the TCGA database (Normal: 52 cases, 6&7&8: 359 cases, 9&10:140 cases). The predictive power of miR-375 in PCa was expressed as the area under the receiver operator characteristic (ROC) curve using the pROC package. Gene set enrichment analysis (GSEA) was adopted to statistically explore differentially expressed genes relevant to the expression of PTPN4 in the TCGA database. First, the raw counts of differentially expressed PTPN4-related genes were downloaded from the TCGA-PRAD data portal by the Deseq2 package version 1.26.0. Then, genes with an adjusted P value <0.05 and log2-fold change >1.5 were considered statistically significant and were used for GSEA. The returned results were visualized via clusterProfiler package version 3.14.3 and ggplot2 package version 3.3.3. The enrichment pathways were evaluated by the P value and normalized enrichment score. GEPIA (http://gepia.cancer-pku.cn/) was performed to obtain the top 100 genes that had similar expression patterns as PTPN4 in prostate cancer. These similar genes were subjected to GO and KEGG analysis using R packages (clusterProfiler package 3.14.3 for enrichment analysis and org.Hs.eg.db package for ID Conversion).

    Real-time PCR

    Total RNA from tissues or cultured cells was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, USA). The miRNA and mRNA were reverse transcribed with a ReverTra Ace qPCR RT Kit (TOYOBO, Japan) in a reaction mixture containing a miR-specific stem-loop reverse transcription primer (miR-375 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCACG) for miRNA or a universal poly (T) primer for mRNA. qRT-PCR was carried out using TransStartR Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) and a SteponePlus Real-Time PCR system (Applied Biosystems, USA) to assess gene expression. GAPDH was used as a reference for mRNA levels, and U6 was used as a reference for miRNA levels. The sequences of the primers used are listed in Supplementary Table 1. Each PCR assay was repeated thrice.

    Western blot

    Western blotting was performed as previously described16. All of the antibodies used in this article are listed in Supplementary Table 2.

    Dual-luciferase reporter gene assay

    Fragments of the wild-type (WT) or mutant (MUT) 3′UTR of PTPN4 containing miR-375 binding sites were subcloned into the P-MIR-Report firefly luciferase vector. The sequence of pri-miR-375 was subcloned into the pCDH-CMV vector (pCDH-375). The cloning and mutation-introducing primers are listed in Supplementary Table 3. The WT or MUT firefly luciferase vector along with the Renilla luciferase vector (used as a protein loading control) were cotransfected with pCDH-375 or pCDH-empty (negative control) vector into HEK-293 cells. Forty-eight hours post-transfection, the cells were harvested and lysed. The luciferase activity of the lysate was detected with a Dual-Glo® Luciferase Assay System (Promega, Wisconsin, USA).

    Cell transfection

    To upregulate or downregulate the expression of miR-375, DU145 and PC-3 cells were transfected with pSUPER-RETRO-Puro-miR-375, pSUPER-RETRO-Puro-NC, pHB-U6-MCS-PGK-PURO-miR-375 sponge (sp miR-375), and pHB-U6-MCS-PGK-PURO-NC (Hanbio Biotechnology, Shanghai, China) by using jetPRIME® (Polyplus-transfection® SA, Strasbourg, France). In brief, cells were seeded into six-well plates for 24 h before transfection. When the cell confluence reached 50–80%, the cells were transfected using jetPRIME®. After the medium was changed 4 h later, the cells were cultured for another 20 hours and screened with puromycin (DU145 1.5 µg/mL; PC-3 1 µg/mL). Colonies containing more than 50–100 cells were isolated, propagated, identified for the level of miR-375, and cultured for future use.

    For the rescue experiment, cells overexpressing miR-375 were transfected with pcDNA3.1-PTPN4 recombinant or pcDNA3.1-empty plasmid (InvitrogenTM Life Technologies, California, America). In parallel with PTPN4 overexpression, cells with miR-375 knockdown were transfected with siPTPN4 or siNC (Hanbio Biotechnology, Shanghai, China) by using jetPRIME®. The primers for subcloning and the target sequence of PTPN4 and the short interfering RNA targeting PTPN4 are presented in Supplementary Table 4.

    Cell proliferation assays

    In the CCK-8 assays, transfected cells (5 × 103 cells/well) were seeded. Cell proliferation was detected at 24, 48, 72, and 96 h using a CCK-8 kit (Dojindo, Kumamoto, Japan) following the manufacturer’s instructions. The absorbance at 450 nm was measured. Additionally, according to the manufacturer’s instructions, a Cell-Light TM EdU Apollo 567 In Vitro kit (Ribobio, Guangzhou, China) was utilized to assay EdU incorporation in the cells.

    Apoptosis analysis

    Cells were harvested and washed three times, followed by treatment with 5 µL Annexin V-FITC (Dojindo, Japan) and 5 µL PI for 15 min in the dark at room temperature. Apoptotic cells were fractioned by flow cytometry (BD FACSAriaTM II, New Jersey, USA).

    Cell migration and invasion assays

    Cells (5 × 105/well) were maintained in six-well plates until they reached 100% confluence. A 10-µl pipette tip was applied to generate a wound, and the cell layer was then washed to remove detached cells. Next, the cells were incubated in serum-free RPMI 1640 at 37 °C for 24 h. The wound was photographed under a microscope at 0 h and 24 h, and the rate of closure was calculated with ImageJ software.

    For the transwell assay, miR-375 -overexpressing or miR-375-silenced DU145 and PC-3 cells (5 × 104) in serum-free RPMI 1640 were seeded into inner chambers with or without precoated Matrigel (Corning, New York, USA). RPMI 1640 containing 10% FBS was added to the outer chambers. After 16–24 h, the cells remaining in the inner chamber were removed with a cotton swab, and the cells migrated through the pores were fixed with 4% paraformaldehyde for 1 h. After the cells were stained with crystal violet for 1 hour, microscopic photographs were taken, and the number of migrated cells was counted.

    Enzalutamide sensitivity analysis

    Cells (8 × 103 cells/well) were incubated overnight. Then, they were exposed to different concentrations of enzalutamide (0, 1, 2, 4, 8, 16, 32, 64 µmol/L) and cultured for another 3 days. Cell viability was evaluated using a CCK-8 assay.

    Isolation and identification of hucMSCs

    Fresh human umbilical cords were obtained from the Second Affiliated Hospital of Harbin Medical University with informed consent. Mesenchymal progenitor cells were cultured in serum-free MesenCult-ACF Plus Medium (05448, STEMCELL, Canada) immediately after the umbilical cord had been harvested. After perivascular Wharton’s jelly was incubated in 5% CO2 at 37 °C for 10–14 days until the cells (P0) were confluent around the colonization point, the hucMSCs were passaged, and the hucMSCs at the 4th passage were used for further analysis and experiments. Flow cytometry was used to detect the surface markers of the hucMSCs (refer to Supplementary Table 2 for the antibodies). To evaluate their potential for multiple differentiation, hucMSCs were cultured and induced in osteogenic, adipogenic, and chondrogenic differentiation medium (Biological Industries, Israel) for 6–21 days, followed by Alizarin red (MSC Osteo-Staining Kit, MC37C0-1.4, VivaCell Biosciences, China), Oil red O (MSC Adipo-Staining Kit, MC37A0-1.4, VivaCell Biosciences, China), and Alcian blue (MSC Chondro-Staining Kit, MC37B0-1.4, VivaCell Biosciences, China) staining.

    Exosome isolation and characterization

    The serum-free supernatants of P4 hucMSCs were centrifuged at 4000 × g for 30 min, filtered through a 0.22 µm filter, and ultracentrifuged at 100,000 × g for 3 h at 4 °C (OptimaXPN-100 Ultracentrifuge). After the supernatant was removed, the pellet was suspended in PBS and ultracentrifuged for 2 h. The collected exosomes were resuspended in PBS and stored at −80 °C before use. Flow NanoAnalyzer N30 (NanoFCM Inc., Xiamen, China) was used to determine the size and concentration of exosomes. The morphological features of exosomes were detected with transmission electron microscopy (TEM; Hitachi 7500, Japan). Western blotting was used to assess surface markers, including CD63 (ab134045, Abcam), CD81 (ab79559, Abcam), and TSG101 (ab125011, Abcam).

    Cellular uptake of PKH67-labeled exosomes

    To visualize the internalization of exosomes in DU145 and PC-3 cells, exosomes were stained with PKH67 (MINI67-1KT, Sigma-Aldrich, USA) in Diluent C. The mixture was filtered with a diffusiometer (Centrifugal Filter Units, Merck KGaA, Germany) to remove the excess dye. The PKH67-labeled exosomes were cocultured with DU145 and PC-3 cells for 24 h, followed by visualization under a confocal fluorescence microscope.

    Xenograft model

    Four-week-old male BALB/c nude mice were obtained from Beijing Vital River Laboratory. A total of 4 × 106 DU145 cells stably transfected with empty vector (Vector), miR-375 expression vector (miR-375) or miR-375 sponge vector (sp miR-375) were mixed with Matrigel (1:1) and subcutaneously injected into the backs of mice (8 mice per group). One week later, the mice were surgically castrated under anesthesia. When tumor volume were around ~50 mm3, each of the three groups of mice were again randomly stratified into two subgroups (4 mice per subgroup): (1) Vector (95% corn oil+5% DMSO, ip, 200 µl), (2) Vector + enzalutamide (10 mg/kg, ip, 200 µl), (3) miR-375 (95% corn oil + 5% DMSO, ip, 200 µl), (4) miR-375+ enzalutamide (10 mg/kg, ip, 200 µl), (5) sp miR-375 (95% corn oil+5% DMSO, ip, 200 µl), (6) sp miR 375+ enzalutamide (10 mg/kg, ip, 200 µl). Tumor size was measured twice a week, and the tumor volume was calculated with the formula: tumor volume = length × width2 × 0.5. The mice were sacrificed 30 days after subcutaneous injection. A fraction of the tumor tissue was fixed in 4% paraformaldehyde solution for hematoxylin and eosin (HE) and immunohistochemical staining analysis (IHC), and the rest was immediately stored at −80 °C for western blotting and real-time PCR.

    For metastasis analysis, miR-375-overexpressing and miR-375-depleted DU145 cells (2 × 105/100 µl) were injected into the mice through the tail vein (n = 4 per group). Eight weeks post injection, the mice were euthanized, and the lungs were removed. The metastatic tumor foci in the lungs were visualized and quantified by fixing the lungs in 4% paraformaldehyde, paraffin embedding the lungs and HE staining of serially sliced sections at 2 mm intervals.

    To evaluate the in vivo function of e-375i, 4 × 106/100 µl DU145 cells mixed with 100 µl Matrigel were subcutaneously injected into the backs of mice. Three days after injection, the mice were randomized into two groups (n = 5). Exosomes (1 × 109) carrying NC oligonucleotides (5 nmol, e-NC group) or miR-375 antisense oligonucleotides (5 nmol, e-375i group) were intraperitoneally injected twice a week. Tumor volume and body weight were measured every 2 days until the mice were sacrificed 30 days after inoculation. The excised tumors were partially soaked in 4% paraformaldehyde and embedded in paraffin for IHC, and the rest were immediately stored at −80 °C for western blotting and real-time PCR.

    HE and IHC staining

    The tissue sections were stained for H&E, and IHC for Ki-67, PTPN4, AR, E-cadherin and Vimentin was performed as previously described17. Image-Pro Plus 6.0 was utilized to assess the average integrated optical density of the staining when the IHC images were loaded into the software.

    Statistical analysis

    Data analysis was performed using GraphPad Prism 8. The data are presented as the mean ± SEM. Student’s t test or one-way analysis of variance was utilized to calculate statistical significance. The association between miR-375 and Gleason score was statistically determined with the Kruskal-Wallis test and Dunn’s test. Statistical results with *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 were statistically significant.

    Categories
    Prostate cancer

    GSTM2 is a key molecular determinant of resistance to SG-ARIs

  • Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72:7–33.

    PubMed 
    Article 

    Google Scholar
     

  • Teo MY, Rathkopf DE, Kantoff P. Treatment of advanced prostate cancer. Annu Rev Med. 2019;70:479–99.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Coutinho I, Day TK, Tilley WD, Selth LA. Androgen receptor signaling in castration-resistant prostate cancer: a lesson in persistence. Endocr Relat Cancer. 2016;23:T179–t197.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Higano C. Enzalutamide, apalutamide, or darolutamide: are apples or bananas best for patients?. Nat Rev Urol. 2019;16:335–6.

    PubMed 
    Article 

    Google Scholar
     

  • Scher HI, Fizazi K, Saad F, Taplin ME, Sternberg CN, Miller K, et al. Increased survival with enzalutamide in prostate cancer after chemotherapy. N Engl J Med. 2012;367:1187–97.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Smith MR, Saad F, Chowdhury S, Oudard S, Hadaschik BA, Graff JN, et al. Apalutamide treatment and metastasis-free survival in prostate cancer. N Engl J Med. 2018;378:1408–18.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Fizazi K, Shore N, Tammela TL, Ulys A, Vjaters E, Polyakov S, et al. Darolutamide in nonmetastatic, castration-resistant prostate cancer. N Engl J Med. 2019;380:1235–46.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Shiota M, Yokomizo A, Naito S. Oxidative stress and androgen receptor signaling in the development and progression of castration-resistant prostate cancer. Free Radic Biol Med. 2011;51:1320–8.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Kumar B, Koul S, Khandrika L, Meacham RB, Koul HK. Oxidative stress is inherent in prostate cancer cells and is required for aggressive phenotype. Cancer Res. 2008;68:1777–85.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Hayes JD, Dinkova-Kostova AT, Tew KD. Oxidative stress in cancer. Cancer Cell. 2020;38:167–97.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Sies H, Berndt C, Jones DP. Oxidative stress. Annu Rev Biochem. 2017;86:715–48.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Neha K, Haider MR, Pathak A, Yar MS. Medicinal prospects of antioxidants: a review. Eur J Med Chem. 2019;178:687–704.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Allocati N, Masulli M, Di C. Glutathione transferases: substrates, inihibitors and pro-drugs in cancer and neurodegenerative diseases. Oncogenesis. 2018;7:8.

    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar
     

  • Zhou SG, Wang P, Pi RB, Gao J, Fu JJ, Fang J, et al. Reduced expression of GSTM2 and increased oxidative stress in spontaneously hypertensive rat. Mol Cell Biochem. 2008;309:99–107.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Han I, Jeong SJ, Lee HJ, Koh W, Lee HJ, Lee EO, et al. Proteomic analysis of mesenchymal stem-like cells derived from ovarian teratoma: potential role of glutathione S-transferase M2 in ovarian teratoma. Proteomics. 2011;11:352–60.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Guo E, Wei H, Liao X, Wu L, Zeng X. Clinical significance and biological mechanisms of glutathione S-transferase mu gene family in colon adenocarcinoma. BMC Med Genet. 2020;21:130.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Andonova IE, Justenhoven C, Winter S, Hamann U, Baisch C, Rabstein S, et al. No evidence for glutathione S-transferases GSTA2, GSTM2, GSTO1, GSTO2, and GSTZ1 in breast cancer risk. Breast Cancer Res Treat. 2010;121:497–502.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Tang SC, Wu CH, Lai CH, Sung WW, Yang WJ, Tang LC, et al. Glutathione S-transferase mu2 suppresses cancer cell metastasis in non-small cell lung cancer. Mol Cancer Res. 2013;11:518–29.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Peng L, Zhuang L, Lin K, Yao Y, Zhang Y, Arumugam T, et al. Downregulation of GSTM2 enhances gemcitabine chemosensitivity of pancreatic cancer in vitro and in vivo. Pancreatology. 2021;21:115–23.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Buenrostro JD, Wu B, Chang HY, Greenleaf WJ. ATAC-seq: a method for assaying chromatin accessibility genome-wide. Curr Protoc Mol Biol. 2015;109:21.29.1–9.

    Article 

    Google Scholar
     

  • Li C, Lanman NA, Kong Y, He D, Mao F, Farah E, et al. Inhibition of the erythropoietin-producing receptor EPHB4 antagonizes androgen receptor overexpression and reduces enzalutamide resistance. J Biol Chem. 2020;295:5470–83.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Ricci G, De Maria F, Antonini G, Turella P, Bullo A, Stella L, et al. 7-Nitro-2,1,3-benzoxadiazole derivatives, a new class of suicide inhibitors for glutathione S-transferases. Mechanism of action of potential anticancer drugs. J Biol Chem. 2005;280:26397–405.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Bhattacharjee P, Paul S, Banerjee M, Patra D, Banerjee P, Ghoshal N, et al. Functional compensation of glutathione S-transferase M1 (GSTM1) null by another GST superfamily member, GSTM2. Sci Rep. 2013;3:2704.

    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Sagar YK. Does glutathione transferase loading into exosomes from prostate cancer cells influence progression? 2016. https://eprints.qut.edu.au/98015/.

  • Li Y, Chan SC, Brand LJ, Hwang TH, Silverstein KA, Dehm SM. Androgen receptor splice variants mediate enzalutamide resistance in castration-resistant prostate cancer cell lines. Cancer Res. 2013;73:483–9.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Zhao L, Au JL, Wientjes MG. Comparison of methods for evaluating drug-drug interaction. Front Biosci. 2010;2:241–9.


    Google Scholar
     

  • Hayes JD, Dinkova-Kostova AT, McMahon M. Cross-talk between transcription factors AhR and Nrf2: lessons for cancer chemoprevention from dioxin. Toxicol Sci. 2009;111:199–201.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Rothhammer V, Quintana FJ. The aryl hydrocarbon receptor: an environmental sensor integrating immune responses in health and disease. Nat Rev Immunol. 2019;19:184–97.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Shiota M, Yokomizo A, Tada Y, Inokuchi J, Kashiwagi E, Masubuchi D, et al. Castration resistance of prostate cancer cells caused by castration-induced oxidative stress through Twist1 and androgen receptor overexpression. Oncogene. 2010;29:237–50.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Dolado I, Swat A, Ajenjo N, De Vita G, Cuadrado A, Nebreda AR. p38alpha MAP kinase as a sensor of reactive oxygen species in tumorigenesis. Cancer Cell. 2007;11:191–205.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Canovas B, Nebreda AR. Diversity and versatility of p38 kinase signalling in health and disease. Nat Rev Mol Cell Biol. 2021;22:346–66.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Zhao J, Ning S, Lou W, Yang JC, Armstrong CM, Lombard AP, et al. Cross-resistance among next-generation antiandrogen drugs through the AKR1C3/AR-V7 axis in advanced prostate cancer. Mol Cancer Ther. 2020;19:1708–18.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Clegg NJ, Wongvipat J, Joseph JD, Tran C, Ouk S, Dilhas A, et al. ARN-509: a novel antiandrogen for prostate cancer treatment. Cancer Res. 2012;72:1494–503.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Moilanen AM, Riikonen R, Oksala R, Ravanti L, Aho E, Wohlfahrt G, et al. Discovery of ODM-201, a new-generation androgen receptor inhibitor targeting resistance mechanisms to androgen signaling-directed prostate cancer therapies. Sci Rep. 2015;5:12007.

    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Cancer Genome Atlas Research Network. The molecular taxonomy of primary prostate cancer. Cell. 2015;163:1011–25. https://pubmed.ncbi.nlm.nih.gov/26544944/.

  • Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010;18:11–22.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Abida W, Cyrta J, Heller G, Prandi D, Armenia J, Coleman I, et al. Genomic correlates of clinical outcome in advanced prostate cancer. Proc Natl Acad Sci USA. 2019;116:11428–36.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Hamdy FC, Donovan JL, Lane JA, Mason M, Metcalfe C, Holding P, et al. 10-year outcomes after monitoring, surgery, or radiotherapy for localized prostate cancer. N Engl J Med. 2016;375:1415–24.

    PubMed 
    Article 

    Google Scholar
     

  • Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1:417–25.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Alumkal JJ, Sun D, Lu E, Beer TM, Thomas GV, Latour E, et al. Transcriptional profiling identifies an androgen receptor activity-low, stemness program associated with enzalutamide resistance. Proc Natl Acad Sci USA. 2020;117:12315–23.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • He Y, Wei T, Ye Z, Orme JJ, Lin D, Sheng H, et al. A noncanonical AR addiction drives enzalutamide resistance in prostate cancer. Nat Commun. 2021;12:1521.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Zhao SG, Chen WS, Li H, Foye A, Zhang M, Sjöström M, et al. The DNA methylation landscape of advanced prostate cancer. Nat Genet. 2020;52:778–89.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Davies A, Nouruzi S, Ganguli D, Namekawa T, Thaper D, Linder S, et al. An androgen receptor switch underlies lineage infidelity in treatment-resistant prostate cancer. Nat Cell Biol. 2021;23:1023–34.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Zhang Z, Zhou C, Li X, Barnes SD, Deng S, Hoover E, et al. Loss of CHD1 promotes heterogeneous mechanisms of resistance to AR-targeted therapy via chromatin dysregulation. Cancer Cell. 2020;37:584–.e11.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Gibbons JA, Ouatas T, Krauwinkel W, Ohtsu Y, van der Walt JS, Beddo V, et al. Clinical pharmacokinetic studies of enzalutamide. Clin Pharmacokinet. 2015;54:1043–55.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • de Vries R, Jacobs F, Mannens G, Snoeys J, Cuyckens F, Chien C, et al. Apalutamide absorption, metabolism, and excretion in healthy men, and enzyme reaction in human hepatocytes. Drug Metab Dispos. 2019;47:453–64.

    PubMed 
    Article 
    CAS 

    Google Scholar
     

  • Ji C, Guha M, Zhu X, Whritenour J, Hemkens M, Tse S, et al. Enzalutamide and apalutamide: in vitro chemical reactivity studies and activity in a mouse drug allergy model. Chem Res Toxicol. 2020;33:211–22.

    CAS 
    PubMed 
    Article 

    Google Scholar
     

  • Liu C, Lou W, Zhu Y, Yang JC, Nadiminty N, Gaikwad NW, et al. Intracrine androgens and AKR1C3 activation confer resistance to enzalutamide in prostate cancer. Cancer Res. 2015;75:1413–22.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, et al. Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Nat Cell Biol. 2016;18:1311–23.

    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar
     

  • Categories
    Prostate cancer

    Post-diagnostic health behaviour scores in relation to fatal prostate cancer

  • Howlader N, Noone AM, Krapcho M, Miller D, Brest A, Yu M, et al. https://seer.cancer.gov/csr/1975_2017/, based on November 9 SEER data submission, posted to the SEER web site, April 20. (National Cancer Institute, Bethesda, MD).

  • American Cancer Society. Cancer facts and figures 2020. Atlanta: American Cancer Society; 2020.

  • Kenfield SA, Batista JL, Jahn JL, Downer MK, Van Blarigan EL, Sesso HD, et al. Development and application of a lifestyle score for prevention of lethal prostate cancer. J Natl Cancer Inst. 2016;108:djv329.

    PubMed 

    Google Scholar
     

  • Bell K. Remaking the self: trauma, teachable moments, and the biopolitics of cancer survivorship. Cult Med Psychiatry. 2012;36:584–600.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Ganz PA. A teachable moment for oncologists: cancer survivors, 10 million strong and growing! J Clin Oncol. 2005;23:5458–60.

    PubMed 

    Google Scholar
     

  • Karvinen K, Bruner B, Truant T. The teachable moment after cancer diagnosis: perceptions from oncology nurses. Oncol Nurs Forum. 2015;42:602–9.

    PubMed 

    Google Scholar
     

  • Langlais CS, Graff RE, Van Blarigan EL, Palmer NR, Washington SL 3rd, Chan JM, et al. Post-diagnostic dietary and lifestyle factors and prostate cancer recurrence, progression, and mortality. Curr Oncol Rep. 2021;23:37.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • AU – World Cancer Research Fund/American Institute for Cancer Research PY – 2018 ST – Diet, Nutrition, Physical Activity and Cancer: a Global Perspective. Continuous Update Project Expert Report 2018 TI – Diet, Nutrition, Physical Activity and Cancer: a Global Perspective. Continuous Update Project Expert Report 2018 UR -2020. http://www.dietandcancerreport.org/Y2.

  • Rock CL, Doyle C, Demark-Wahnefried W, Meyerhardt J, Courneya KS, Schwartz AL, et al. Nutrition and physical activity guidelines for cancer survivors. CA Cancer J Clin. 2012;62:243–74.

    PubMed 

    Google Scholar
     

  • Shams-White MM, Romaguera D, Mitrou P, Reedy J, Bender A, Brockton NT. Further guidance in implementing the standardized 2018 world cancer research fund/American Institute for Cancer Research (WCRF/AICR) score. Cancer Epidemiol Biomark Prev. 2020;29:889–94.


    Google Scholar
     

  • Shams-White MM, Brockton NT, Mitrou P, Romaguera D, Brown S, Bender A, et al. Operationalizing the 2018 world cancer research fund/American Institute for Cancer Research (WCRF/AICR) cancer prevention recommendations: a standardized scoring system. Nutrients. 2019;11:1572.

  • McCullough ML, Patel AV, Kushi LH, Patel R, Willett WC, Doyle C, et al. Following cancer prevention guidelines reduces risk of cancer, cardiovascular disease, and all-cause mortality. Cancer Epidemiol Biomark Prev. 2011;20:1089–97.


    Google Scholar
     

  • Van Blarigan EL, Fuchs CS, Niedzwiecki D, Zhang S, Saltz LB, Mayer RJ, et al. Association of survival with adherence to the American cancer society nutrition and physical activity guidelines for cancer survivors after colon cancer diagnosis: the CALGB 89803/alliance trial. JAMA Oncol. 2018;4:783–90.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Chasan-Taber S, Rimm EB, Stampfer MJ, Spiegelman D, Colditz GA, Giovannucci E, et al. Reproducibility and validity of a self-administered physical activity questionnaire for male health professionals. Epidemiology. 1996;7:81–6.

    CAS 
    PubMed 

    Google Scholar
     

  • Feskanich D, Rimm EB, Giovannucci EL, Colditz GA, Stampfer MJ, Litin LB, et al. Reproducibility and validity of food intake measurements from a semiquantitative food frequency questionnaire. J Am Diet Assoc. 1993;93:790–6.

    CAS 
    PubMed 

    Google Scholar
     

  • Rimm EB, Giovannucci EL, Stampfer MJ, Colditz GA, Litin LB, Willett WC. Reproducibility and validity of an expanded self-administered semiquantitative food frequency questionnaire among male health professionals. Am J Epidemiol. 1992;135:1114–26.

    CAS 
    PubMed 

    Google Scholar
     

  • Szymanski KM, Wheeler DC, Mucci LA. Fish consumption and prostate cancer risk: a review and meta-analysis. Am J Clin Nutr. 2010;92:1223–33.

    CAS 
    PubMed 

    Google Scholar
     

  • Rohrmann S, Platz EA, Kavanaugh CJ, Thuita L, Hoffman SC, Helzlsouer KJ. Meat and dairy consumption and subsequent risk of prostate cancer in a US cohort study. Cancer Causes Control. 2007;18:41–50.

    PubMed 

    Google Scholar
     

  • Kirsh VA, Mayne ST, Peters U, Chatterjee N, Leitzmann MF, Dixon LB, et al. A prospective study of lycopene and tomato product intake and risk of prostate cancer. Cancer Epidemiol Biomark Prev. 2006;15:92–8.

    CAS 

    Google Scholar
     

  • Rohrmann S, Linseisen J, Allen N, Bueno-de-Mesquita HB, Johnsen NF, Tjønneland A, et al. Smoking and the risk of prostate cancer in the European prospective investigation into cancer and nutrition. Br J Cancer. 2013;108:708–14.

    CAS 
    PubMed 

    Google Scholar
     

  • Patel AV, Rodriguez C, Jacobs EJ, Solomon L, Thun MJ, Calle EE. Recreational physical activity and risk of prostate cancer in a large cohort of US men. Cancer Epidemiol Biomark Prev. 2005;14:275–9.


    Google Scholar
     

  • Wright ME, Chang SC, Schatzkin A, Albanes D, Kipnis V, Mouw T, et al. Prospective study of adiposity and weight change in relation to prostate cancer incidence and mortality. Cancer. 2007;109:675–84.

    PubMed 

    Google Scholar
     

  • Gong Z, Agalliu I, Lin DW, Stanford JL, Kristal AR. Cigarette smoking and prostate cancer-specific mortality following diagnosis in middle-aged men. Cancer Causes Control. 2008;19:25–31.

    PubMed 

    Google Scholar
     

  • Oefelein MG, Resnick MI. Association of tobacco use with hormone refractory disease and survival of patients with prostate cancer. J Urol. 2004;171:2281–4.

    PubMed 

    Google Scholar
     

  • Pantarotto J, Malone S, Dahrouge S, Gallant V, Eapen L. Smoking is associated with worse outcomes in patients with prostate cancer treated by radical radiotherapy. BJU Int. 2007;99:564–9.

    PubMed 

    Google Scholar
     

  • Moreira DM, Aronson WJ, Terris MK, Kane CJ, Amling CL, Cooperberg MR, et al. Cigarette smoking is associated with an increased risk of biochemical disease recurrence, metastasis, castration-resistant prostate cancer, and mortality after radical prostatectomy: results from the search database. Cancer. 2014;120:197–204.

    CAS 
    PubMed 

    Google Scholar
     

  • Pickles T, Liu M, Berthelet E, Kim-Sing C, Kwan W, Tyldesley S. The effect of smoking on outcome following external radiation for localized prostate cancer. J Urol. 2004;171:1543–6.

    CAS 
    PubMed 

    Google Scholar
     

  • Joshu CE, Mondul AM, Meinhold CL, Humphreys EB, Han M, Walsh PC, et al. Cigarette smoking and prostate cancer recurrence after prostatectomy. J Natl Cancer Inst. 2011;103:835–8.

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Oh JJ, Hong SK, Jeong CW, Byun SS, Lee SE. Significance of smoking status regarding outcomes after radical prostatectomy. Int Urol Nephrol. 2012;44:119–24.

    PubMed 

    Google Scholar
     

  • Ngo TC, Lee JJ, Brooks JD, Nolley R, Ferrari M, Presti JC Jr. Smoking and adverse outcomes at radical prostatectomy. Urol Oncol. 2013;31:749–54.

    PubMed 

    Google Scholar
     

  • Rieken M, Shariat SF, Kluth LA, Fajkovic H, Rink M, Karakiewicz PI, et al. Association of cigarette smoking and smoking cessation with biochemical recurrence of prostate cancer in patients treated with radical prostatectomy. Eur Urol. 2015;68:949–56.

    PubMed 

    Google Scholar
     

  • Steinberger E, Kollmeier M, McBride S, Novak C, Pei X, Zelefsky MJ. Cigarette smoking during external beam radiation therapy for prostate cancer is associated with an increased risk of prostate cancer-specific mortality and treatment-related toxicity. BJU Int. 2015;116:596–603.

    CAS 
    PubMed 

    Google Scholar
     

  • Negrón R, Vásquez A, Nieves M, Guerrios L, Irizarry-Ramírez M. Body mass index affects the diagnosis and progression of prostate cancer in hispanics. Ethn Dis. 2010;20:S1–168-72.

    PubMed 

    Google Scholar
     

  • Keto CJ, Aronson WJ, Terris MK, Presti JC, Kane CJ, Amling CL, et al. Obesity is associated with castration-resistant disease and metastasis in men treated with androgen deprivation therapy after radical prostatectomy: results from the search database. BJU Int. 2012;110:492–8.

    CAS 
    PubMed 

    Google Scholar
     

  • Bhindi B, Kulkarni GS, Finelli A, Alibhai SM, Hamilton RJ, Toi A, et al. Obesity is associated with risk of progression for low-risk prostate cancers managed expectantly. Eur Urol. 2014;66:841–8.

    PubMed 

    Google Scholar
     

  • Efstathiou JA, Chen MH, Renshaw AA, Loffredo MJ, D’Amico AV. Influence of body mass index on prostate-specific antigen failure after androgen suppression and radiation therapy for localized prostate cancer. Cancer. 2007;109:1493–8.

    PubMed 

    Google Scholar
     

  • Spangler E, Zeigler-Johnson CM, Coomes M, Malkowicz SB, Wein A, Rebbeck TR. Association of obesity with tumor characteristics and treatment failure of prostate cancer in African-American and European American men. J Urol. 2007;178:1939–44.

    CAS 
    PubMed 

    Google Scholar
     

  • Stroup SP, Cullen J, Auge BK, L’Esperance JO, Kang SK. Effect of obesity on prostate-specific antigen recurrence after radiation therapy for localized prostate cancer as measured by the 2006 radiation therapy oncology group-American society for therapeutic radiation and oncology (RTOG-ASTRO) phoenix consensus definition. Cancer. 2007;110:1003–9.

    PubMed 

    Google Scholar
     

  • Hisasue S, Yanase M, Shindo T, Iwaki H, Fukuta F, Nishida S, et al. Influence of body mass index and total testosterone level on biochemical recurrence following radical prostatectomy. Jpn J Clin Oncol. 2008;38:129–33.

    PubMed 

    Google Scholar
     

  • Magheli A, Rais-Bahrami S, Trock BJ, Humphreys EB, Partin AW, Han M, et al. Impact of body mass index on biochemical recurrence rates after radical prostatectomy: An analysis utilizing propensity score matching. Urology. 2008;72:1246–51.

    PubMed 

    Google Scholar
     

  • Freedland SJ, Isaacs WB, Mangold LA, Yiu SK, Grubb KA, Partin AW, et al. Stronger association between obesity and biochemical progression after radical prostatectomy among men treated in the last 10 years. Clin Cancer Res. 2005;11:2883–8.

    CAS 
    PubMed 

    Google Scholar
     

  • Freedland SJ, Grubb KA, Yiu SK, Humphreys EB, Nielsen ME, Mangold LA, et al. Obesity and risk of biochemical progression following radical prostatectomy at a tertiary care referral center. J Urol. 2005;174:919–22.

    PubMed 

    Google Scholar
     

  • Freedland SJ, Sun L, Kane CJ, Presti JC Jr, Terris MK, Amling CL, et al. Obesity and oncological outcome after radical prostatectomy: impact of prostate-specific antigen-based prostate cancer screening: Results from the shared equal access regional cancer hospital and duke prostate center databases. BJU Int. 2008;102:969–74.

    PubMed 

    Google Scholar
     

  • Strom SS, Wang X, Pettaway CA, Logothetis CJ, Yamamura Y, Do KA, et al. Obesity, weight gain, and risk of biochemical failure among prostate cancer patients following prostatectomy. Clin Cancer Res. 2005;11:6889–94.

    CAS 
    PubMed 

    Google Scholar
     

  • Strom SS, Kamat AM, Gruschkus SK, Gu Y, Wen S, Cheung MR, et al. Influence of obesity on biochemical and clinical failure after external-beam radiotherapy for localized prostate cancer. Cancer. 2006;107:631–9.

    PubMed 

    Google Scholar
     

  • Kane CJ, Im R, Amling CL, Presti JC Jr, Aronson WJ, Terris MK, et al. Outcomes after radical prostatectomy among men who are candidates for active surveillance: results from the search database. Urology. 2010;76:695–700.

    PubMed 

    Google Scholar
     

  • Ho T, Gerber L, Aronson WJ, Terris MK, Presti JC, Kane CJ, et al. Obesity, prostate-specific antigen nadir, and biochemical recurrence after radical prostatectomy: biology or technique? Results from the search database. Eur Urol. 2012;62:910–6.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Wang LS, Murphy CT, Ruth K, Zaorsky NG, Smaldone MC, Sobczak ML, et al. Impact of obesity on outcomes after definitive dose-escalated intensity-modulated radiotherapy for localized prostate cancer. Cancer. 2015;121:3010–7.

    CAS 
    PubMed 

    Google Scholar
     

  • Langlais CS, Cowan JE, Neuhaus J, Kenfield SA, Van Blarigan EL, Broering JM, et al. Obesity at diagnosis and prostate cancer prognosis and recurrence risk following primary treatment by radical prostatectomy. Cancer Epidemiol Biomark Prev. 2019;28:1917–25.


    Google Scholar
     

  • Bonn SE, Sjölander A, Lagerros YT, Wiklund F, Stattin P, Holmberg E, et al. Physical activity and survival among men diagnosed with prostate cancer. Cancer Epidemiol Biomark Prev. 2015;24:57–64.

    CAS 

    Google Scholar
     

  • Wang Y, Jacobs EJ, Gapstur SM, Maliniak ML, Gansler T, McCullough ML, et al. Recreational physical activity in relation to prostate cancer-specific mortality among men with nonmetastatic prostate cancer. Eur Urol. 2017;72:931–9.

    PubMed 

    Google Scholar
     

  • Kenfield SA, Stampfer MJ, Giovannucci E, Chan JM. Physical activity and survival after prostate cancer diagnosis in the health professionals follow-up study. J Clin Oncol. 2011;29:726–32.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Friedenreich CM, Wang Q, Neilson HK, Kopciuk KA, McGregor SE, Courneya KS. Physical activity and survival after prostate cancer. Eur Urol. 2016;70:576–85.

    PubMed 

    Google Scholar
     

  • Richman EL, Kenfield SA, Stampfer MJ, Paciorek A, Carroll PR, Chan JM. Physical activity after diagnosis and risk of prostate cancer progression: data from the cancer of the prostate strategic urologic research endeavor. Cancer Res. 2011;71:3889–95.

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Meyer F, Bairati I, Shadmani R, Fradet Y, Moore L. Dietary fat and prostate cancer survival. Cancer Causes Control. 1999;10:245–51.

    CAS 
    PubMed 

    Google Scholar
     

  • Epstein MM, Kasperzyk JL, Mucci LA, Giovannucci E, Price A, Wolk A, et al. Dietary fatty acid intake and prostate cancer survival in örebro county, Sweden. Am J Epidemiol. 2012;176:240–52.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Van Blarigan EL, Kenfield SA, Yang M, Sesso HD, Ma J, Stampfer MJ, et al. Fat intake after prostate cancer diagnosis and mortality in the physicians’ health study. Cancer Causes Control. 2015;26:1117–26.

    PubMed 
    PubMed Central 

    Google Scholar
     

  • Pettersson A, Kasperzyk JL, Kenfield SA, Richman EL, Chan JM, Willett WC, et al. Milk and dairy consumption among men with prostate cancer and risk of metastases and prostate cancer death. Cancer Epidemiol Biomark Prev. 2012;21:428–36.


    Google Scholar
     

  • Tat D, Kenfield SA, Cowan JE, Broering JM, Carroll PR, Van Blarigan EL, et al. Milk and other dairy foods in relation to prostate cancer recurrence: Data from the cancer of the prostate strategic urologic research endeavor (capsure™). Prostate. 2018;78:32–9.

    CAS 
    PubMed 

    Google Scholar
     

  • Farris MS, Courneya KS, Kopciuk KA, McGregor SE, Friedenreich CM. Post-diagnosis alcohol intake and prostate cancer survival: a population-based cohort study. Int J Cancer. 2018;143:253–62.

    CAS 
    PubMed 

    Google Scholar
     

  • Downer MK, Kenfield SA, Stampfer MJ, Wilson KM, Dickerman BA, Giovannucci EL, et al. Alcohol intake and risk of lethal prostate cancer in the health professionals follow-up study. J Clin Oncol. 2019;37:1499–511.

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Richman EL, Kenfield SA, Stampfer MJ, Giovannucci EL, Chan JM. Egg, red meat, and poultry intake and risk of lethal prostate cancer in the prostate-specific antigen-era: Incidence and survival. Cancer Prev Res. 2011;4:2110–21.

    CAS 

    Google Scholar
     

  • Yang M, Kenfield SA, Van Blarigan EL, Batista JL, Sesso HD, Ma J, et al. Dietary patterns after prostate cancer diagnosis in relation to disease-specific and total mortality. Cancer Prev Res. 2015;8:545–51.

    CAS 

    Google Scholar
     

  • Recommendation: Always say “no” to tobacco. Accessed December 21, 2021. https://www.aicr.org/cancer-prevention/recommendations/always-say-no-to-tobacco/.

  • Tobacco and cancer. Accessed December 21, 2021. https://www.cancer.org/cancer/cancer-causes/tobacco-and-cancer.html.

  • Smoking and cancer risk. Accessed December 19, 2021. https://www.wcrf-uk.org/preventing-cancer/what-can-increase-your-risk-of-cancer/smoking-and-cancer-risk/.

  • Vidal AC, Oyekunle T, Howard LE, De Hoedt AM, Kane CJ, Terris MK, et al. Obesity, race, and long-term prostate cancer outcomes. Cancer. 2020;126:3733–41.

    CAS 
    PubMed 

    Google Scholar
     

  • Khan S, Cai J, Nielsen ME, Troester MA, Mohler JL, Fontham ETH, et al. The association of diabetes and obesity with prostate cancer progression: Hcap-nc. Prostate. 2017;77:878–87.

    CAS 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Riviere P, Kumar A, Luterstein E, Vitzthum LK, Nalawade V, Sarkar RR, et al. Tobacco smoking and death from prostate cancer in us veterans. Prostate Cancer Prostatic Dis. 2020;23:252–9.

    CAS 
    PubMed 

    Google Scholar
     

  • Vidal AC, Howard LE, Sun SX, Cooperberg MR, Kane CJ, Aronson WJ, et al. Obesity and prostate cancer-specific mortality after radical prostatectomy: results from the shared equal access regional cancer hospital (search) database. Prostate Cancer Prostatic Dis. 2017;20:72–8.

    CAS 
    PubMed 

    Google Scholar
     

  • Freedland SJ, Branche BL, Howard LE, Hamilton RJ, Aronson WJ, Terris MK, et al. Obesity, risk of biochemical recurrence, and prostate-specific antigen doubling time after radical prostatectomy: results from the search database. BJU Int. 2019;124:69–75.

    CAS 
    PubMed 

    Google Scholar
     

  • Jackson MD, Tulloch-Reid MK, McCaw-Binns AM, Aiken W, Ferguson TS, Bennett NR, et al. Central adiposity at diagnosis may reduce prostate cancer-specific mortality in African-Caribbean men with prostate cancer: 10-year follow-up of participants in a case-control study. Cancer Causes Control. 2020;31:651–62.

    PubMed 

    Google Scholar
     

  • Rimm EB, Stampfer MJ, Colditz GA, Chute CG, Litin LB, Willett WC. Validity of self-reported waist and hip circumferences in men and women. Epidemiology. 1990;1:466–73.

    CAS 
    PubMed 

    Google Scholar
     

  • Categories
    Prostate cancer

    Should LHRH therapy be continued in patients receiving abiraterone acetate?

  • Ohlmann CH, Jäschke M, Jaehnig P, Krege S, Gschwend J, Rexer H, et al. LHRH sparing therapy in patients with chemotherapy-naïve, mCRPC treated with abiraterone acetate plus prednisone: results of the randomized phase II SPARE trial. Prostate Cancer Prostatic Dis. 2022. https://doi.org/10.1038/s41391-022-00533-6

  • Supiot S, Campion L, Pommier P, Dore M, Palpacuer C, Racadot S, et al. Combined abiraterone acetate plus prednisone, salvage prostate bed radiotherapy and LH-RH agonists (CARLHA-GEP12) in biochemically-relapsing prostate cancer patients following prostatectomy: A phase I study of the GETUG/GEP. Oncotarget. 2018;9:22147–22157. https://doi.org/10.18632/oncotarget.25189

    Article 
    PubMed 
    PubMed Central 

    Google Scholar
     

  • Maluf FC, Schutz FA, Cronemberger EH, Luz MA, Martins SPS, Muniz DQB, et al. A phase 2 randomized clinical trial of abiraterone plus ADT, apalutamide, or abiraterone and apalutamide in patients with advanced prostate cancer with non-castrate testosterone levels (LACOG 0415). Eur J Cancer. 2021;158:63–71. https://doi.org/10.1016/j.ejca.2021.08.032

    CAS 
    Article 
    PubMed 

    Google Scholar
     

  • Mariani S, Salvatori L, Basciani S, Arizzi M, Franco G, Petrangeli E, et al. Expression and cellular localization of follicle-stimulating hormone receptor in normal human prostate, benign prostatic hyperplasia and prostate cancer. J Urol. 2006;175:2072–7. https://doi.org/10.1016/S0022-5347(06)00273-4

    CAS 
    Article 
    PubMed 

    Google Scholar
     

  • Radu A, Pichon C, Camparo P, Antoine M, Allory Y, Couvelard A, et al. Expression of follicle-stimulating hormone receptor in tumor blood vessels. N Engl J Med. 2010;363:1621–30. https://doi.org/10.1056/NEJMoa1001283

    CAS 
    Article 
    PubMed 

    Google Scholar
     

  • Categories
    Prostate cancer

    Risk of progression following a negative biopsy in prostate cancer active surveillance

  • Bruinsma SM, Bangma CH, Carroll PR, Leapman MS, Rannikko A, Petrides N, et al. Active surveillance for prostate cancer: a narrative review of clinical guidelines. Nat Rev Urol. 2016;13:151–67.

    CAS 
    Article 

    Google Scholar
     

  • Kinsella N, Helleman J, Bruinsma S, Carlsson S, Cahill D, Brown C, et al. Active surveillance for prostate cancer: a systematic review of contemporary worldwide practices. Transl Androl Urol. 2018;7:83–97.

    Article 

    Google Scholar
     

  • Wagenlehner FM, van Oostrum E, Tenke P, Tandogdu Z, Cek M, Grabe M, et al. Infective complications after prostate biopsy: outcome of the Global Prevalence Study of Infections in Urology (GPIU) 2010 and 2011, a prospective multinational multicentre prostate biopsy study. Eur Urol. 2013;63:521–7.

    Article 

    Google Scholar
     

  • Ploussard G, Renard-Penna R. MRI-guided active surveillance in prostate cancer: not yet ready for practice. Nat Rev Urol. 2021;18:77–8.

    Article 

    Google Scholar
     

  • Cary KC, Cowan JE, Sanford M, Shinohara K, Perez N, Chan JM, et al. Predictors of pathologic progression on biopsy among men on active surveillance for localized prostate cancer: the value of the pattern of surveillance biopsies. Eur Urol. 2014;66:337–42.

    Article 

    Google Scholar
     

  • Ganesan V, Dai C, Nyame YA, Greene DJ, Almassi N, Hettel D, et al. Prognostic significance of a negative confirmatory biopsy on reclassification among men on active surveillance. Urology. 2017;107:184–9.

    Article 

    Google Scholar
     

  • Singh S, Sandhu P, Beckmann K, Santaolalla A, Dewan K, Clovis S, et al. Negative first follow-up prostate biopsy on active surveillance is associated with decreased risk of upgrading, suspicion of progression and converting to active treatment. BJUI Int. 2021;128:72–8.

    CAS 
    Article 

    Google Scholar
     

  • Wong LM, Alibhai SM, Trottier G, Timilshina N, Van der Kwast T, Zlotta A, et al. A negative confirmatory biopsy among men on active surveillance for prostate cancer does not protect them from histologic grade progression. Eur Urol. 2014;66:406–13.

    Article 

    Google Scholar
     

  • Kearns JT, Faino AV, Newcomb LF, Brooks JD, Carroll PR, Dash A, et al. Role of surveillance biopsy with no cancer as a prognostic marker for reclassification: results from the canary prostate active surveillance study. Eur Urol. 2018;73:706–12.

    Article 

    Google Scholar
     

  • Bruinsma SM, Zhang L, Roobol MJ, Bangma CH, Steyerberg EW, Nieboer D, et al. The Movember Foundation’s GAP3 cohort: a profile of the largest global prostate cancer active surveillance database to date. BJU Int. 2018;121:737–44.

    Article 

    Google Scholar
     

  • Lewicki P, Shoag J, Golombos DM, Oromendia C, Ballman KV, Halpern JA, et al. Prognostic significance of a negative prostate biopsy: an analysis of subjects enrolled in a prostate cancer screening trial. J Urol. 2017;197:1014–9.

    Article 

    Google Scholar
     

  • Chu CE, Cowan JE, Fasulo V, Washington SL 3rd, de la Calle C, Shoemaker J, et al. The clinical significance of multiple negative surveillance prostate biopsies for men on active surveillance-does cancer vanish or simply hide? J Urol. 2021;205:109–14.

    Article 

    Google Scholar
     

  • Loeb S, Vellekoop A, Ahmed HU, Catto J, Emberton M, Nam R, et al. Systematic review of complications of prostate biopsy. Eur Urol. 2013;64:876–92.

    Article 

    Google Scholar
     

  • Bokhorst LP, Alberts AR, Rannikko A, Valdagni R, Pickles T, Kakehi Y, et al. Compliance rates with the prostate cancer research international active surveillance (PRIAS) protocol and disease reclassification in noncompliers. Eur Urol. 2015;68:814–21.

    Article 

    Google Scholar
     

  • Kalapara AA, Verbeek JFM, Nieboer D, Fahey M, Gnanapragasam V, Van Hemelrijck M, et al. Adherence to active surveillance protocols for low-risk prostate cancer: results of the movember foundation’s global action plan prostate cancer active surveillance initiative. Eur Urol Oncol. 2020;3:80–91.

    Article 

    Google Scholar
     

  • Loeb S, Curnyn C, Fagerlin A, Braithwaite RS, Schwartz MD, Lepor H, et al. Qualitative study on decision-making by prostate cancer physicians during active surveillance. BJU Int. 2017;120:32–9.

    Article 

    Google Scholar
     

  • Xu J, Neale AV, Dailey RK, Eggly S, Schwartz KL. Patient perspective on watchful waiting/active surveillance for localized prostate cancer. J Am Board Fam Med. 2012;25:763–70.

    Article 

    Google Scholar
     

  • Beckmann K, Cahill D, Brown C, Van Hemelrijck M, Kinsella J. Understanding reasons for non-adherence to acitve surveillance for low-intermediate risk prostate cancer. Transl Androl Urol. 2021;10:2728–36.

    Article 

    Google Scholar
     

  • Bul M, Zhu X, Valdagni R, Pickles T, Kakehi Y, Rannikko A, et al. Active surveillance for low-risk prostate cancer worldwide: the PRIAS study. Eur Urol. 2013;63:597–603.

    Article 

    Google Scholar
     

  • Beckmann K, Bangma C, Helleman J, Santaolalla A, Nieboer D, Bjartell A, et al. Comparison of different biopsy schedules among men on active surveillance: analysis of the GAP3 Global Consortium database. J Urol. 2020;203:e1291.

    Article 

    Google Scholar
     

  • Nieboer D, Tomer A, Rizopoulos D, Roobol MJ, Steyerberg EW. Active surveillance: a review of risk-based, dynamic monitoring. Transl Androl Urol. 2018;7:106–15.

    Article 

    Google Scholar
     

  • Ankerst DP, Xia J, Thompson IM Jr., Hoefler J, Newcomb LF, Brooks JD, et al. Precision medicine in active surveillance for prostate cancer: development of the canary-early detection research network active surveillance biopsy risk calculator. Eur Urol. 2015;68:1083–8.

    Article 

    Google Scholar
     

  • Drost FH, Nieboer D, Morgan TM, Carroll PR, Roobol MJ. Movember foundation’s global action plan prostate cancer active surveillance C. Predicting biopsy outcomes during active surveillance for prostate cancer: external validation of the canary prostate active surveillance study risk calculators in five large active surveillance cohorts. Eur Urol. 2019;76:693–702.

    Article 

    Google Scholar
     

  • Borque-Fernando A, Rubio-Briones J, Esteban LM, Collado-Serra A, Pallas-Costa Y, Lopez-Gonzalez PA, et al. The management of active surveillance in prostate cancer: validation of the Canary Prostate Active Surveillance Study risk calculator with the Spanish Urological Association Registry. Oncotarget 2017;8:108451–62.

    Article 

    Google Scholar
     

  • Tomer A, Nieboer D, Roobol MJ, Bjartell A, Steyerberg EW, Rizopoulos D, et al. Personalised biopsy schedules based on risk of Gleason upgrading for patients with low-risk prostate cancer on active surveillance. BJU Int. 2021;127:96–107.

    Article 

    Google Scholar
     

  • Moore CM, Parker C. The evolution of active surveillance for prostate cancer. Eur Urol. 2015;68:822–3.

    Article 

    Google Scholar
     

  • Schoots IG, Petrides N, Giganti F, Bokhorst LP, Rannikko A, Klotz L, et al. Magnetic resonance imaging in active surveillance of prostate cancer: a systematic review. Eur Urol. 2015;67:627–36.

    Article 

    Google Scholar
     

  • Stavrinides V, Giganti F, Trock B, Punwani S, Allen C, Kirkham A, et al. Five-year outcomes of magnetic resonance imaging-based active surveillance for prostate cancer: a large cohort study. Eur Urol. 2020;78:443–51.

    CAS 
    Article 

    Google Scholar
     

  • Ahlberg MS, Adami HO, Beckmann K, Bertilsson H, Bratt O, Cahill D, et al. PCASTt/SPCG-17-a randomised trial of active surveillance in prostate cancer: rationale and design. BMJ Open. 2019;9:e027860.

    Article 

    Google Scholar
     

  • National Institute for Health and Care Excellence. Prostate cancer: Diagnosis and management, NICE Guideline [NG131] 2019 [Available from: https://www.nice.org.uk/guidance/ng131/chapter/Recommendations#assessment-and-diagnosis.

  • Manceau C, Fromont G, Beauval JB, Barret E, Brureau L, Crehange G, et al. Biomarker in active surveillance for prostate cancer: a systematic review. Cancers (Basel). 2021;13:4251.

    CAS 
    Article 

    Google Scholar
     

  • Categories
    Prostate cancer

    Frozen section utilization to omit systematic biopsy in diagnosing high risk prostate cancer

    The high sensitivity of MRI has led to its incorporation into the diagnostic pathway as an initial test prior to biopsy. A systematic review on mpMRI detection of prostate cancer reported a sensitivity of 93%, a negative predictive value of 89%, and a specificity of 41%1. With the introduction of MRI, prostate biopsy techniques have evolved to further improve the diagnostic uncertainty of previous random biopsies. Targeted prostate biopsy utilizing MRI for guiding tissue sampling has been reported to improve the detection rate of csPCa while lowering the detection of clinically insignificant prostate cancer2. However, targeted biopsy alone is not recommended in most reports owing to the undetected csPCa on mpMRI in up to 16–28% of the cases and the multifocality of prostate cancer, which is known to be present in 60–90% of cases9,10,11. Therefore, current guidelines suggest that targeted prostate biopsies should be performed in combination with a systematic biopsy for a more accurate risk stratification that could further impact treatment decisions. However, the high detection rate of targeted biopsy for PI-RADS 5 lesions suggest that the detection rate of a targeted biopsy could be further increased and potentially warrant the omission of systematic biopsies in more specifically selected patients. Therefore, patients with a PIRADS-5 lesion on MRI with additional high-risk features (with an extracapsular extension or PSA level > 20 ng/mL) may benefit from a frozen section biopsy because these subgroup of patients need only a histologic diagnosis without further risk assessment with a systematic biopsy. Frozen section biopsy provides immediate results to omit systematic biopsy in cases of a positive result for cancer; however, a 16-core systematic biopsy can be performed in cases of a negative result to mitigate the potential risk of missing prostate cancer.

    The cancer detection rate for high-risk patients with frozen section-targeted biopsy alone was 97.0% (63/65 patients). There were three cases where an additional systematic biopsy was performed owing to the negative results of a targeted biopsy using frozen sections. In one case, an additional systematic biopsy was performed, and the pathology was reported to be a prostate abscess. If we were to have performed a routine systematic biopsy in combination with targeted biopsy for these high-risk patients with PI-RADS 5 lesions, 95.5% (63/66) of these patients would have undergone an additional systematic biopsy without any benefit.

    Regarding treatment course, 31 (51.7%) patients underwent whole-gland treatment initially with radical prostatectomy or radiation therapy. Twenty-nine (48.3%) patients underwent systemic therapy with hormonal therapy alone or in combination with chemotherapy. An additional systematic biopsy would not have deviated the course of treatment for these patients.

    The most commonly reported minor complications related to transrectal biopsies were hematospermia (36.3%), hematuria (14.5%), and rectal bleeding (2.3%). Rectal bleeding requiring intervention was reported in 0.6% of the patients. Other reported complications include urinary tract infection (0.8%) and urinary retention (0.2%)14. Additionally, the risks of antimicrobial resistance and urosepsis have been reported to increase with the number of cores sampled15. Though the biopsy technique adopted in this study utilizes a transperineal approach, it is speculated that frozen sections utilized in a transrectal approach for target biopsy may provide similar benefits of a significant reduction in the number of biopsy cores. No complications associated with the procedures were noted in any of the 66 patients in this study.

    The major advantage of incorporating a frozen section biopsy is that the total biopsy cores obtained can be significantly reduced by omitting a systematic biopsy without compromising the risk of missing diagnoses of prostate cancer. Reducing the number of cores sampled may lower the risk of antimicrobial resistance and urosepsis, as they have been reported to increase with the number of cores sampled15. Furthermore, the time from suspicion to diagnosis and eventually to treatment is shortened, and the anxiety experienced by patients in these intervals is lowered. However, when an accurate risk assessment is required, a systematic biopsy should be added to targeted biopsy cores to improve the local staging in order to plan the optimal therapeutic strategy16.

    The procedure presented in this study has limitations. Obtaining frozen section biopsy results requires a pathologist to be readily able to assess the specimen, which may not be possible in local practices. However, by omitting a routine systematic biopsy, the total number of biopsy cores that need to be reviewed by the pathologist can be significantly reduced, leading to a decrease in the burden on pathologists as well. In addition, time for a pathologic report for frozen section can be time consuming and may exceed performing a systematic biopsy. The total operation time consumed in this study was a mean 25.3 ± 5.7 min which is similar to MRI–US fusion-targeted transperineal prostate biopsies with systematic biopsies that are performed in our institute. However, a reduction in biopsy cores may enable this method to be performed in an out-patient setting under local anesthesia where the patient can wait in the waiting room until the pathology result is reported. Another limitation is that MRI must be performed preoperatively to perform an MRI fusion biopsy, which can be expensive in certain countries. However, owing to the national health insurance policy in Korea, the patients are not economically burdened. Lastly, the number of cases included in this study was small; a larger trial is required to make any definitive conclusions.

    Categories
    Prostate cancer

    Olaparib + Abiraterone Gets Priority Review for mCRPC

    The Food and Drug Administration (FDA) has accepted for Priority Review the supplemental New Drug Application (sNDA) for olaparib in combination with abiraterone and prednisone or prednisolone for the treatment of adults with metastatic castration-resistant prostate cancer (mCRPC).

    The sNDA is supported by data from the randomized, double-blind, phase 3 PROpel trial (ClinicalTrials.gov Identifier: NCT03732820) which evaluated the efficacy and safety of olaparib in 796 adults with mCRPC who had not received prior chemotherapy or new hormonal agents (NHAs) in the first-line setting. Patients were enrolled regardless of homologous recombination repair gene mutation (HRRm) status. Patients were randomly assigned 1:1 to receive either olaparib 300mg orally twice daily or placebo, in addition to abiraterone and prednisone or prednisolone.

    The primary endpoint was radiological progression free survival (rPFS), defined as the time from randomization to radiological progression, as assessed by investigator per RECIST 1.1 and PCWG-3, or death from any cause, whichever occurred first.


    Continue Reading

    According to primary analysis at the first data cutoff, the median rPFS was statistically significantly longer in the olaparib arm compared with the placebo arm, 24.8 vs 16.6 months, respectively (hazard ratio, 0.66; 95% CI, 0.54-0.81; P <.0001) correlating with a 34% risk reduction of disease progression or death. At data cutoff, overall survival data (secondary endpoint) were immature. 

    The safety and tolerability profile of olaparib and abiraterone was consistent with that observed in previous studies and the known profiles of the individual drugs. The most common adverse reactions were anemia (46%), fatigue (37%) and nausea (28%); adverse events of Grade 3 or worse were anemia (15%), hypertension (4%), urinary tract infection (2%), fatigue (2%), decreased appetite (1%), vomiting (1%), back pain (1%), diarrhea (1%) and nausea (0.3%). 

    A Prescription Drug User Fee Act target date in the fourth quarter of 2022 has been set for this application.

    Susan Galbraith, executive vice president, oncology R&D, AstraZeneca, said, “There remains a critical unmet need among patients diagnosed with mCRPC, where the prognosis remains poor, and treatment options are limited. Today’s news is another step towards bringing forward a new, much-needed treatment option in this setting. If approved, Lynparza with abiraterone will become the first combination of a PARP inhibitor and a new hormonal agent for patients with this disease.”

    Olaparib, a poly (ADP-ribose) polymerase (PARP) inhibitor, is marketed under the trade name Lynparza and is currently approved for the treatment of adults with deleterious or suspected deleterious germline or somatic HRR gene-mutated mCRPC who have progressed following prior treatment with enzalutamide or abiraterone.

    Additionally, Lynparza is indicated for the treatment of ovarian cancer, breast cancer, and pancreatic cancer.

    References

    1. FDA accepts submission of supplemental New Drug Application for Lynparza® (olaparib) in combination with abiraterone and prednisone or prednisolone for patients with metastatic castration-resistant prostate cancer and grants Priority Review. News release. AstraZeneca and Merck. Accessed August 16, 2022. https://www.businesswire.com/news/home/20220816005290/en/FDA-Accepts-Submission-of-Supplemental-New-Drug-Application-for-LYNPARZA%C2%AE-olaparib-in-Combination-With-Abiraterone-and-Prednisone-or-Prednisolone-for-Patients-With-Metastatic-Castration-Resistant-Prostate-Cancer-and-Grants-Priority-Review
    2. Clarke NW, Armstrong AJ, Thiery-Vuillemin A, et al. Abiraterone and olaparib for metastatic castration-resistant prostate cancer. N Engl J Med. Published online June 3, 2022. doi:10.1056/EVIDoa2200043

    This article originally appeared on MPR